View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19879_high_1 (Length: 433)
Name: NF19879_high_1
Description: NF19879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19879_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 417; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 1 - 425
Target Start/End: Original strand, 29817186 - 29817610
Alignment:
| Q |
1 |
ttcttcttctagacttgttgtcagggcaaccgatgaggctgccccggctgcacctgctgccgccgctgctccagctgctgatgcagctcctactcctaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29817186 |
ttcttcttctagacttgttgtcagggcaaccgatgaggctgccccggctgcacctgctgcccccgctgctccagctgctgatgcagctcctactcctaaa |
29817285 |
T |
 |
| Q |
101 |
cccaagccaccaccaattggccccaagagaggttctaaggtaattagtttcccaatatgctgattatcatattaagatagacaatatagaagtatatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29817286 |
cccaagccaccaccaattggccccaagagaggttctaaggtaattagtttcccaatatgctgattatcatattaagatagacaatatagaagtatatatt |
29817385 |
T |
 |
| Q |
201 |
taaaattgcatgaatgatgattatactaggatcccacttatttcatttgtcaattgtttttaagttctctattgcatctactgccataagatgtattgca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29817386 |
taaaattgcatgaatgatgattatactaggatcccacttatttcatttgtcaattgtttttaagttctctattgcatctactgccataagatgtattgca |
29817485 |
T |
 |
| Q |
301 |
acaaagtagtctcttgttgcaattatacattggtttagtttgaatttacttatttatggtgtatcaaagcttttcaattcaaattaatttatgattcttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29817486 |
acaaagtagtctcttgttgcaattatacattggtttagtttgaatttacttatttatggtgtatcaaagcttttcaattcaaattaatttatgattcttc |
29817585 |
T |
 |
| Q |
401 |
atttataaaatgatactactgatga |
425 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
29817586 |
atttataaaatgatactacttatga |
29817610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University