View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19880_low_3 (Length: 297)
Name: NF19880_low_3
Description: NF19880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19880_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 33613330 - 33613608
Alignment:
| Q |
1 |
ttattggagaaatacttggaattaattctaaaataggaatagagaggttcctagtgagtagtgagtgggtgccgtactatcacggaggtgaggaataaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33613330 |
ttattggagaaatacttggaattagttctaaaataggaatagagt--ttcctagtgagtagtgagtgggtgccgtactatcacggaggtgaggaataaaa |
33613427 |
T |
 |
| Q |
101 |
cgggtgaatattcggttatggtggtgctcatctcagtggggaccaacacacagatattctgagctgctgacacaaaaatcgtccataatgcgacctgcga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33613428 |
cgggtgaatattcggttatggtggtgctcatctcagtggggaccaacacacagatgttctgagctgctgacacaaaaatcgtccataatgcgacctgcga |
33613527 |
T |
 |
| Q |
201 |
ttcccaaataggacagggacgatgcaagaaatgcatcaagagtcaagactacttatacacaaagatattgcaaggattttg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33613528 |
ttcccaaataggacagggacgatgcaagaaatgcatcaagagtcaagactacttatacacaaagatattgcaaggattttg |
33613608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University