View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19881_low_7 (Length: 239)
Name: NF19881_low_7
Description: NF19881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19881_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 49698965 - 49699174
Alignment:
| Q |
12 |
ggcatgcagatggtggcagatgtttttggtggtgttagtgttctacactgcatgggtgtcaccatttgaattcgggttcttgaatgaacctttgagacct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49698965 |
ggcatgcagatggtggcagatgtttttggtggtgttagtgttctacactgcatgggtgtcaccatttgaattcgggttcttgaatgaacctttgagacct |
49699064 |
T |
|
| Q |
112 |
ctttcaattactgataatgttgtgaatataatatttttctttgatatttggttaactttctttgttgcttactatgacaaaactacgtatttgcttgtgg |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49699065 |
ctttcgattactgataatgttgtgaatataatatttttctttgatatttggttaactttctttgttgcttactatgacaaaactacgtatttgcttgtgg |
49699164 |
T |
|
| Q |
212 |
atagccatgg |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
49699165 |
atagccatgg |
49699174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University