View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19882_high_3 (Length: 380)
Name: NF19882_high_3
Description: NF19882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19882_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 8 - 313
Target Start/End: Original strand, 43174680 - 43174983
Alignment:
| Q |
8 |
ccaagaatatcttcttgctgtcaatttatttgaaaattttaccacttacggttaagctaattttggggaacgtgacacgcaatttcaagtggaaactact |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43174680 |
ccaacaatatcttcttgctgtcaatttatttgaaaattttaccacttacggttaagctaattttggggaacgtgacacgcaatttcaagtggaaactact |
43174779 |
T |
|
| Q |
108 |
agcaagaaatgtagcctatgctaaagtaatgttttcattgtctctccctaaaagaaaaagggatgaagagatgagagcgagtgaccatagagtatagaca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43174780 |
agcaagaaatgtagcctatgctaaagtaatgttttcattgtctctccctaaaagaaaaagggatgaagagatgagagcgagtgaccatagagtatagaca |
43174879 |
T |
|
| Q |
208 |
accgttgaataagaaatgttgatagtgtcttccnnnnnnnnnnnnggaaagaaatgttgatagtgtcttcccttgattaattttgagagattactctatt |
307 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43174880 |
accgtggaataagaaatgttgatagtgtcttcc--ttttttttttggaaagaaatgttgatagtgtcttcccttgattaattttgagagattactctatc |
43174977 |
T |
|
| Q |
308 |
ttaaaa |
313 |
Q |
| |
|
|||||| |
|
|
| T |
43174978 |
ttaaaa |
43174983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 305 - 367
Target Start/End: Original strand, 43175168 - 43175230
Alignment:
| Q |
305 |
attttaaaaagggttttttggatggtgtgcataaggttatttatattattgttagaggttctt |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43175168 |
attttaaaaagggttttttggatggtgtgcataaggttatttatattattgttagaggttctt |
43175230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 43166156 - 43166243
Alignment:
| Q |
97 |
tggaaactactagcaagaaatgtagcctatgctaaagtaatgttttcattgtctctccctaaaagaaaaagggatgaagagatgagag |
184 |
Q |
| |
|
||||||||||||||||| || || || | ||||||||||||||||| ||||||||||| || |||||||| |||||||| ||||||| |
|
|
| T |
43166156 |
tggaaactactagcaaggaaggtggcatcagctaaagtaatgttttccttgtctctcccaaagagaaaaagagatgaagaaatgagag |
43166243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University