View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19882_high_6 (Length: 314)
Name: NF19882_high_6
Description: NF19882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19882_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 49180519 - 49180320
Alignment:
| Q |
21 |
tgaggaaccatgaatagtatgcatagtgaacgaaaggaagatcaaacaaaacacagacacagtctcaaacctgacttccagccctgtagcagcaaactca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180519 |
tgaggaaccatgaatagtatgcatagtgaacgaaaggaagatcaaacaaaacacagacacagtctcaaacctgacttccagccctgtagcagcaaactca |
49180420 |
T |
 |
| Q |
121 |
tcttatacgtggcatatagccatttttgtaagtcactgcattaaacaaagaatttaacaggaatccttccccgcgttcaatagcaactagcagcattttc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180419 |
tcttatacgtggcatatagccatttttgtaagtcactgcattgaacaaagaatttaacaggaatccttccccgcgttcaatagcaactagcagcattttc |
49180320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 215 - 302
Target Start/End: Complemental strand, 49180247 - 49180160
Alignment:
| Q |
215 |
attttcccacaaaagttaacaattatgtagttgtcaaccatgcaataggtgaaggacaaatttagtgattttcacctttaatgaccta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180247 |
attttcccacaaaagttaacaattatgtagttgtcaaccatgcaataggtgaaggacaaatttagtgattttcacctttaatgaccta |
49180160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University