View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19882_low_5 (Length: 336)
Name: NF19882_low_5
Description: NF19882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19882_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 19 - 328
Target Start/End: Original strand, 30942684 - 30942990
Alignment:
| Q |
19 |
cctcatagtcatagctcttcttaattgaagatgcaggttattttttgagctttattacatacaattaggaagtttgttgaactacgaatcaacatttcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30942684 |
cctcatagtcatagctcttcttaattgaagatgcaggttattttttgagctttattacatacaattaggaagtttgttgaactacgaatcaacatttcta |
30942783 |
T |
|
| Q |
119 |
tcatgcaggttattttttgagttttattacatacaattaggnnnnnnnnnggccctgtccctgtgataactcgtttacttttagctaattaggtctatca |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30942784 |
tcatgcaggttatttt--gagttttattacatacaattaggttcttttt-ggccctgtccctgtgataactcgtttacttttagctaattaggtctatca |
30942880 |
T |
|
| Q |
219 |
attttttatgcacataatggtttacaagaaatataaaatcttctatcaagaaatataaattctacaggatcagagaccatcaaacatgttttctaaatag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30942881 |
attttttatgcacataatggtttacaagaaatataaaatcttctatcaagaaatataaattctacaggatcagagaccatcaaacatgttttctaaatag |
30942980 |
T |
|
| Q |
319 |
atgcatggac |
328 |
Q |
| |
|
|||||||||| |
|
|
| T |
30942981 |
atgcatggac |
30942990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University