View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19882_low_7 (Length: 272)
Name: NF19882_low_7
Description: NF19882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19882_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 30942831 - 30943093
Alignment:
| Q |
1 |
ggccctgtccctgtgataactcgtttacttttagctaattaggtctatcaattttttatgcacataatggtttacaagaaatataaaatcttctatcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30942831 |
ggccctgtccctgtgataactcgtttacttttagctaattaggtctatcaattttttatgcacataatggtttacaagaaatataaaatcttctatcaag |
30942930 |
T |
 |
| Q |
101 |
aaatataaattctacaggatcagagaccatcaaacatgttttctaaatagatgcatggac----nnnnnnnngaaaatagatagacaaattacactagag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
30942931 |
aaatataaattctacaggatcagagaccatcaaacatgttttctaaatagatgcatggacaaaaaaaaaaaaaaaaattgatagacaaattacactagag |
30943030 |
T |
 |
| Q |
197 |
aaacatgcacatcattttggtgtgtgcttttcaaaaaggaaattccaaaattgtctatgagaa |
259 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30943031 |
aaacatacacatcattttggtgtgtgcttttcaaaaagggaattccaaaattgtctatgagaa |
30943093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University