View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19882_low_9 (Length: 228)
Name: NF19882_low_9
Description: NF19882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19882_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 30 - 221
Target Start/End: Original strand, 26437141 - 26437344
Alignment:
| Q |
30 |
ggtttatacacatttttatgagcttccatttctagcaacaggtaagattgcatgtaatggttagttatgcagaaaattgttctacagcaagtttgcatat |
129 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26437141 |
ggtttatacacacttttatgagcttccatttctagcaacgggtaagattgcatgtaatggttagttatgcagaaaattgttctacagcaagtttgcatat |
26437240 |
T |
|
| Q |
130 |
ttagtgctatttgtgtatgaaacctgca------------taatgttataaaaaaggcatcctgcagtttttgttataaatcagcataaagtttttgttc |
217 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
26437241 |
ttagtgctattagtgtatgaaacttgcattatccttgtggtaatgttataaaaaaagcatcctgcagtttttgttataactcagcataaagtttgtgttc |
26437340 |
T |
|
| Q |
218 |
tacc |
221 |
Q |
| |
|
|||| |
|
|
| T |
26437341 |
tacc |
26437344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 34
Target Start/End: Original strand, 26437067 - 26437095
Alignment:
| Q |
6 |
atgttgttaggtgttgcacaaactggttt |
34 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26437067 |
atgttgttaggtgttgcacaaactggttt |
26437095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University