View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19883_low_11 (Length: 209)
Name: NF19883_low_11
Description: NF19883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19883_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 5065888 - 5066074
Alignment:
| Q |
1 |
tcttcttcttcttcatctctctccctcttcacttgcagcactctcccacttgagaaagatgaattaacaacactatgaggtgatgaagtttgtctacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5065888 |
tcttcttcttcttcatctctctccctcttcacttgcagtactctcccacttgagaaagatgaattaacaacactatgaggtgatgaagtttgtctacaaa |
5065987 |
T |
 |
| Q |
101 |
gttcctcaccataacctttggtagcttgtttgtgacttataaggttataactctcaccagagagtcctaacgttaaggatggctcgt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5065988 |
gttcctcaccataacctttggtagcttgtttgtgacttataaggttataactctcaccagagagtcctaacgttaaggatggctcgt |
5066074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 131
Target Start/End: Original strand, 33173259 - 33173314
Alignment:
| Q |
76 |
tgaggtgatgaagtttgtctacaaagttcctcaccataacctttggtagcttgttt |
131 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
33173259 |
tgaggtgatgaattttgtctacaaagttcatcaccataagctttgagagcttgttt |
33173314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University