View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19883_low_8 (Length: 237)
Name: NF19883_low_8
Description: NF19883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19883_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 9736103 - 9735876
Alignment:
| Q |
1 |
agtgtagattcgaaaaggaggggcatggttcctcttgtggtggttcccattaaaaagtaagttcaatctcttacaa-------ctcatggggcataatgg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9736103 |
agtgtagattcgaaaaggaggggcatggttcctcttgtggtggttcccattaaaaagtaagttcaatctcttacaagttacaactcatggggcataatgg |
9736004 |
T |
 |
| Q |
94 |
tgccgattgaacataagttgtaaagggtccctttatcatcctaattatgttgataccattgatttgctcatgtgcatgagaatgagaacctaaataaata |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9736003 |
tgccgattgaacataagttgtaaagggtccctttatcatcctaattatgttgataccattgatttgctcatgtgcatgagaatgagaacctaaataaata |
9735904 |
T |
 |
| Q |
194 |
aaaatcttagataacatgacatcgatga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9735903 |
aaaatcttagataacatgacatcgatga |
9735876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University