View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19883_low_9 (Length: 222)
Name: NF19883_low_9
Description: NF19883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19883_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 27 - 201
Target Start/End: Complemental strand, 24524324 - 24524150
Alignment:
| Q |
27 |
aattcctccaaacttggaaataacttcctgcattcattggcacgatactgcatccaaatttatttctgatattacgaaaattcccctcgtcttacattca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24524324 |
aattcctccaaacttggaaataacttcctgcattcattggcacgatactgcatccaaatttatttctgatattacgaaaattcccctcgtcttacattca |
24524225 |
T |
 |
| Q |
127 |
accattcaggatattgaaacggacaagatctcgcttgagattttgtcttctaagttctgttagatgcatgcttca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
24524224 |
accattcaggatattgaaacggacaagatctcgcttgagattttgtcttctaatttctgttagatgaatgcttca |
24524150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 24524090 - 24524053
Alignment:
| Q |
166 |
attttgtcttctaagttctgttagatgcatgcttcaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24524090 |
attttgtcttctaagttctgttagatgcatgcttcaac |
24524053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 24524326 - 24524354
Alignment:
| Q |
1 |
tggattgaaggctcgtaaaaatctataat |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24524326 |
tggattgaaggctcgtaaaaatctataat |
24524354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University