View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19884_low_8 (Length: 236)
Name: NF19884_low_8
Description: NF19884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19884_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2449899 - 2450119
Alignment:
| Q |
1 |
ttttcatgttagaattgctatcctaaataagaatgggtgtatttggcattttgaacaaaaaatatactcttgaccattgttttatggtaaataaaaattt |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| | ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
2449899 |
ttttcatgttagaattgctgtcctaaataagaatggttgtatttggcattttgaacaaaaaatctgctcttgacctttgttttatgataaataaaaattt |
2449998 |
T |
|
| Q |
101 |
aggcaagttgggttatggggactcgccagggccaatgaaagaatcaaggcgcagaaagtgctaacagatttactctcgactttgctgtcaaaggctatgc |
200 |
Q |
| |
|
|||| || ||||||| ||||||| ||||||||||||||||||||||||| || ||||||| ||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
2449999 |
aggcgagctgggttaaagggactcaccagggccaatgaaagaatcaaggcacataaagtgccgacagagatactcttgactttactgtcaaaggctatgc |
2450098 |
T |
|
| Q |
201 |
tatgcatgcgatagtaaaagt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2450099 |
tatgcatgcgatagtaaaagt |
2450119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University