View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19885_high_4 (Length: 247)
Name: NF19885_high_4
Description: NF19885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19885_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 32250975 - 32250758
Alignment:
| Q |
1 |
tctattatgaggttttgtcattagttcaattacgattcaaggaaacttgatttatataaaggcaaatcttagggaaaagagtaactcaatagtcaatact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
32250975 |
tctattatgaggttttgtcattagttcaattacgattcaaggaaacttgatttatataaaggaaaatcttagggaaaatagtaactcaatactcaatact |
32250876 |
T |
|
| Q |
101 |
aactattcctccaacaaacttcaaagggataaataagggataaatagattccctcaagagatgatgtaaacagcataatcactaatctttatttcctcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32250875 |
aactattcctccaacaaacttcaaagggata-----------aatagattccctcaagagatgatg---------taatcactaatctttatttcctcaa |
32250796 |
T |
|
| Q |
201 |
ctagattccattaatccaaatttacatggaaagatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32250795 |
ctagattccattaatccaaatttacatggaaagatatt |
32250758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University