View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19885_low_6 (Length: 247)
Name: NF19885_low_6
Description: NF19885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19885_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 32251062 - 32251292
Alignment:
| Q |
1 |
ttgaagttataaggatattctagannnnnnnnnccacatatatatgtttctatcgaattctaaaataaaatatttatgagtattatatcttacaataatg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32251062 |
ttgaagttataaggatattctagatttttttttccacatatatatgtttctatcgaattctaaaatcaaatatttatgagtattatatcttacaataatg |
32251161 |
T |
 |
| Q |
101 |
nnnnnnnnnngttctgcaaatatggtcctaaatattaattccttattgcttaacacttgcaggcaccacttcaaatgaatttgttacagattctgcatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32251162 |
ttttttttt-gttctgcaaatatggtcctaaatattaattccttattgcttaacacttgcaggcaccacttcaaatgaatttgttacagattctgcatct |
32251260 |
T |
 |
| Q |
201 |
gtagcttcaagcataaaatatcatgctgagtt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32251261 |
gtagcttcaagcataaaatatcatgctgagtt |
32251292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University