View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19885_low_9 (Length: 224)
Name: NF19885_low_9
Description: NF19885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19885_low_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 25 - 224
Target Start/End: Original strand, 2645375 - 2645574
Alignment:
| Q |
25 |
aatgacgatcacattttgtcgttgtcgttatatcatgttttggcgggttaaccaccctcgatttaaaactatttgaaaattctagttgaaatagcgcggg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
2645375 |
aatgacgatcacattttgtcgttgtcgttatatcatattttggcgggttaaccaccctcgatttaaaactattttaaaattctagttgaaatagcgtggg |
2645474 |
T |
 |
| Q |
125 |
aacagttaaaacaagtaattatgaatggtgtttaaggtagaattgaaaaacctttaagctgccatcacatctacatggtgcttcaagtctatagatccat |
224 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2645475 |
aacagttaaaacaggtaattatgaatggtgtttaaggtagaattgaaaaacctttaagctgccatcacatctacatggtgcttcaagtctatagatccat |
2645574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University