View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19886_high_12 (Length: 294)
Name: NF19886_high_12
Description: NF19886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19886_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 32214004 - 32213875
Alignment:
| Q |
1 |
tcaaatgtttttgtaaataatttcaactaatctatgttgtccactaat---taagcactacgcactagtgttatatgaaaatgtctacatcaataatgtt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32214004 |
tcaaatgtttttgtaaataatttcaactaatctatgttgtccactaagcactacgcactacgcactagtgttatatgaaaatgtctatatcaataatgtt |
32213905 |
T |
 |
| Q |
98 |
cacttttcatgaaaccaatataatataatc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32213904 |
cacttttcatgaaaccaatataatataatc |
32213875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University