View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19886_low_11 (Length: 332)
Name: NF19886_low_11
Description: NF19886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19886_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 32 - 315
Target Start/End: Original strand, 45086680 - 45086969
Alignment:
| Q |
32 |
ttctctatggcggcagaactttccaccgccacaaacttaaagctctataatctcctccaaccctcaacttcttc------cccttcccctaaaacactgt |
125 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45086680 |
ttctctatggcggcagaactttacaccgccacaaccttaaagccctacaatctcctccaaccctcaacttcttccccttccccttcccctaaaacactgt |
45086779 |
T |
 |
| Q |
126 |
tcttcacccctttaagaagtttccctcatagcaaaatccttgaaacccaaagaacaagaaaatcaacatgcttcaccgtttgtgttctaacggaagatcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45086780 |
tcttcacccctttaagaagtttccctcatagcaaaatccttgaaacccaaagaacaagaaaatcaacatgcttcaccgtttgtgttctaacggaagatcc |
45086879 |
T |
 |
| Q |
226 |
aaaacatacatcccaggtgaaaactgaggaagaaatagttgcacaaaaattggctagaaagaagtctcaaagattcacttacctagttgc |
315 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45086880 |
aaaacatacatcccagttgaaaactgaggaagaaatagttgcacaaaaattggctagaaagaagtctcaaagattcacttacctagttgc |
45086969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University