View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19887_high_1 (Length: 492)
Name: NF19887_high_1
Description: NF19887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19887_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-156; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 204 - 487
Target Start/End: Original strand, 41705459 - 41705742
Alignment:
| Q |
204 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705459 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
41705558 |
T |
|
| Q |
304 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705559 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
41705658 |
T |
|
| Q |
404 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaaccaaagactgcggttcatctcact |
487 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41705659 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaaccaaagactgcggttcatttcact |
41705742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 41705256 - 41705399
Alignment:
| Q |
1 |
atcacactcttcatttcacattcttcatctcaaatgctactattacctctaacacactcactctccataatagaattcaacacaacccaccacctcctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41705256 |
atcacactcttcatttcacattcttcatctcaaatgctactattacctctaacacactcactctccatgatagaattcaacacaacccaccacctcctta |
41705355 |
T |
|
| Q |
101 |
aatccacctcaactcactcattatcacgcttccaccgccataaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705356 |
aatccacctcaactcactcattatcacgcttccaccgccataaa |
41705399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 226 - 306
Target Start/End: Complemental strand, 3744418 - 3744338
Alignment:
| Q |
226 |
caacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaa |
306 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || ||||||||||||||||| || |||| ||| | ||||| ||||||||| |
|
|
| T |
3744418 |
caactcataacactctacatggacacaggtagcgaccttgtttggttcccttgttcacctttcgaatgcattctctgtgaa |
3744338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University