View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19889_high_11 (Length: 339)
Name: NF19889_high_11
Description: NF19889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19889_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 18 - 327
Target Start/End: Complemental strand, 14337584 - 14337275
Alignment:
| Q |
18 |
atgtcgatgtctgataactgtcgaacaacaaacaaagcttcaatctgtgtcggctgtgcataggttttgagttgggggagcacatattcgtgtggtcaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14337584 |
atgtcgatgtctgataactgtcgaacaacaaacaaagcttcaatctgtgtcggctgtgcataggttttgagttgggggagcacatattcgtgtggtcaca |
14337485 |
T |
 |
| Q |
118 |
tacttttgcatttatactggtcttctttaattttgccatctcttgccaaaaaagtttaannnnnnngttgttgcatttgtaccatcatgtggaatatgct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14337484 |
tacttttgcatttatactggtcttctttaattttgccatctcttgtcaaaaaagtttaatttttttgttgttgcatttgtaccatcatgtggaatatgct |
14337385 |
T |
 |
| Q |
218 |
gtgttgcttaaagtaccaagagtctatggtatatgatgatctatgataaagttagctctctatcctctcttgccaaatctcagccgttggcttactcttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
14337384 |
gtgttgcttaaagtaccaagagtctatggtatatgatgatctatgataaagttagctctctatcctctcttgccaaatcttagccgttggcttaatcttg |
14337285 |
T |
 |
| Q |
318 |
cttttgggat |
327 |
Q |
| |
|
| |||||||| |
|
|
| T |
14337284 |
catttgggat |
14337275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University