View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19889_low_18 (Length: 289)
Name: NF19889_low_18
Description: NF19889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19889_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 18 - 172
Target Start/End: Complemental strand, 33102408 - 33102256
Alignment:
| Q |
18 |
tgtttgagtaacataaaatttatgcaaccttgttaagtgtgtgaatttcttacattgaactgagtttgtgtcttgaaattcatttggtgcaactaagttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
33102408 |
tgtttgagtaacataaaatttatgcaaccttgttaagtgagtgaatttcttgcatggaactgagtttgtgacttgaaagtcatttggtgcaactaagttg |
33102309 |
T |
 |
| Q |
118 |
aaaaatagagatcatgatagaactaaatttatttttgtgggaagtttatatgacc |
172 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102308 |
aaaaat--agatcataatataactaaatttatttttgtgggaagtttatatgacc |
33102256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University