View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_high_24 (Length: 283)
Name: NF1988_high_24
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 49969 - 49705
Alignment:
| Q |
1 |
ccatgtttccctcgaccaacatannnnnnntatctactgctcagcctactgtctgctgataggattaaaatttctaaaaatgttgtggaaaatatgccct |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49969 |
ccatgtttccctcgaccaacataccccccctatctactgctcagcctaccgtctgctgataggattaaaatttctaaaaatgttgtggaaaatatgccct |
49870 |
T |
 |
| Q |
101 |
aaacaaatgtctagttctgtacattgaataattgtttatttttctttgtactagtagtaggctcttgagattttggtgagttttttgttccaggttgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49869 |
aaacaaatgtctagttctgtacattgaataattgtttatttttctttgtactagtagtaggctcttgagattttggtgagttttttgttccaggttgtaa |
49770 |
T |
 |
| Q |
201 |
ttgatgacagatataaatatcaatttattctatcttgttatataaaaatagatatggcacgaatc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49769 |
ttgatgacagatataaatatcaatttattctatcttgttatataaaaatagatatggcacgaatc |
49705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University