View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_high_27 (Length: 264)
Name: NF1988_high_27
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 6617963 - 6617720
Alignment:
| Q |
1 |
cttcgtctcatgggtgaatctgtgatgctttgtttttgcgagcatacgttaacctcttttgtgctttatttttgtgaccaaccaaaaccttctgctgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6617963 |
cttcgtctcatgggtgaatctgtgatgctttgtttttgcgagcatacgttaacctcttttgtgctttatttttgcgaccaaccaaaaccttctgctgcca |
6617864 |
T |
|
| Q |
101 |
tgcgctgtttctgcgaccagaactcatcctctctcttgctctgttttcgcaaccaaaattatctcctgttctgtgtttattttgggcaccgagttctgtc |
200 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6617863 |
tg-----tttctgctaccagaactcatcctctctcttgctctgttttcgcaaccaaaattatctcctgttgtgtgtttattttgggcaccgagttctgtc |
6617769 |
T |
|
| Q |
201 |
attttgtgctctgtttatcgtgaccagaagcccctacttgtgtactgat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6617768 |
attttgtgctctgtttatcgtgaccagaagcccctacttgtgtactgat |
6617720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University