View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_high_31 (Length: 249)
Name: NF1988_high_31
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_high_31 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 108032 - 107865
Alignment:
| Q |
8 |
tagcataggagagacttggaattttatgtgtttaggtggattcaaagtttggggttgaatgttgcatacttgactcacaactagtagttgaagaagccgt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
108032 |
tagcaaaggagagacttggaattttatgtgtttaggtggattcaaagtttggggttgaatgttgtatacttgactcacaactagtagtt---gaagccgt |
107936 |
T |
 |
| Q |
108 |
atataatcacactatttggttttataactgctcaatcatctattcaatgatcttctttgtcattccttcaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
107935 |
atataatcacactatttggttttataactgctcaatcatctattcaatgatcttctttgtcattccttcaa |
107865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 43599217 - 43599175
Alignment:
| Q |
207 |
actactagaaaaatcaattttagagagggtagaaatccgtcac |
249 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43599217 |
actactaaaaaaatcaattttagagagggtagaaatccgtcac |
43599175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 3583583 - 3583541
Alignment:
| Q |
207 |
actactagaaaaatcaattttagagagggtagaaatccgtcac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3583583 |
actactagaaaaatcaattttagagagggtagaaatccgtcac |
3583541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 207 - 249
Target Start/End: Original strand, 16433157 - 16433199
Alignment:
| Q |
207 |
actactagaaaaatcaattttagagagggtagaaatccgtcac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16433157 |
actactagaaaaatcaattttagagagggtagaaatccgtcac |
16433199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 42262445 - 42262404
Alignment:
| Q |
207 |
actactagaaaaatcaattttagagagggtagaaatccgtca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42262445 |
actactagaaaaatcaattttagagagggtagaaatccgtca |
42262404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 30219287 - 30219245
Alignment:
| Q |
207 |
actactagaaaaatcaattttagagagggtagaaatccgtcac |
249 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30219287 |
actattagaaaaatcaattttagagagggtagaaatccgtcac |
30219245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 20389319 - 20389274
Alignment:
| Q |
202 |
tttaaactactagaaaaatcaattttagagagggtagaaatccgtca |
248 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20389319 |
tttacactgctagaaaaatcaattttagag-gggtagaaatccgtca |
20389274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 88420 - 88378
Alignment:
| Q |
207 |
actactagaaaaatcaattttagagagggtagaaatccgtcac |
249 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
88420 |
actactagaaatatcaattttagagagggtataaatccgtcac |
88378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 249
Target Start/End: Original strand, 19899536 - 19899578
Alignment:
| Q |
207 |
actactagaaaaatcaattttagagagggtagaaatccgtcac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
19899536 |
actactagaaaaatcaattttagagagggtaaaaatctgtcac |
19899578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 235
Target Start/End: Complemental strand, 5883350 - 5883322
Alignment:
| Q |
207 |
actactagaaaaatcaattttagagaggg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5883350 |
actactagaaaaatcaattttagagaggg |
5883322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University