View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_high_33 (Length: 242)
Name: NF1988_high_33
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 29261652 - 29261820
Alignment:
| Q |
19 |
gtataccactcagtgcagaacattacatgaaacaaccaaaaccatgatatcttggatgtactatgtttaaaaatgaaccagttaatgttaaatctccatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29261652 |
gtataccactcagtgcagaacattacatgaaacaaccaaaaccatgatatcttggatgtactatgtttaaaaatgaaccagttaattttaaatctccatt |
29261751 |
T |
 |
| Q |
119 |
tatctataactgttggatcatccatattcttgttgacccttcttgtcgatacttaaggatcttctccttgcaaa |
192 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29261752 |
aatctataactgttggatcacccgcattcttgttgacccttctt-----aacttaaggatcttctccttgcaaa |
29261820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 199 - 236
Target Start/End: Original strand, 29261873 - 29261910
Alignment:
| Q |
199 |
tttccaattatatcttgtccaatgtgaacatgatgatg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29261873 |
tttccaattatatcttgtccaatgtgaacattatgatg |
29261910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 62 - 192
Target Start/End: Complemental strand, 26706569 - 26706439
Alignment:
| Q |
62 |
atgatatcttggatgtactatgtttaaaaatgaaccagttaatgttaaatctccatttatctataactgttggatcatccatattcttgttgacccttct |
161 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| || |||||||||| ||||||||||||||||| | || |||||||||| ||||||| |
|
|
| T |
26706569 |
atgatatcttggatgtactaagtttgaaaatgaaccagttaatttttaatctccattaatctataactgttggattacccgcattcttgttggcccttct |
26706470 |
T |
 |
| Q |
162 |
tgtcgatacttaaggatcttctccttgcaaa |
192 |
Q |
| |
|
| || |||||||||||||||||||||||||| |
|
|
| T |
26706469 |
tatcaatacttaaggatcttctccttgcaaa |
26706439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University