View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1988_high_38 (Length: 217)

Name: NF1988_high_38
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1988_high_38
NF1988_high_38
[»] chr4 (2 HSPs)
chr4 (135-193)||(3245801-3245859)
chr4 (1-49)||(3245941-3245989)


Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 135 - 193
Target Start/End: Complemental strand, 3245859 - 3245801
Alignment:
135 acgagaatgttttagaattaagacccacaaacatcgccatttgacatgttcttgtctca 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3245859 acgagaatgttttagaattaagacccacaaacatcgccatttgacatgttcttgtctca 3245801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3245989 - 3245941
Alignment:
1 tcttgaatccttcttcttctctcttctgtattgttgttgttgctagcca 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
3245989 tcttgaatccttcttcttctctcttctgtattgttgttgttgctagcca 3245941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University