View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_high_40 (Length: 214)
Name: NF1988_high_40
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_high_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 11308520 - 11308445
Alignment:
| Q |
14 |
agaatattccacaaaacaacgagaaaacgaaaacataagaacgggaaacggtgtcgtgggaagcagcaacaacatt |
89 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11308520 |
agaaaattccacaaaacaacgagaaaacgaaaacataagaacgggaaacggtgtcgtgggaagcagcaacaacatt |
11308445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 164
Target Start/End: Complemental strand, 11308400 - 11308370
Alignment:
| Q |
134 |
ttacaattatgttcattcattaaactagtgg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11308400 |
ttacaattatgttcattcattaaactagtgg |
11308370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University