View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_low_14 (Length: 368)
Name: NF1988_low_14
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_low_14 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 199 - 368
Target Start/End: Original strand, 43062191 - 43062359
Alignment:
| Q |
199 |
ccttgaggaagaaaccaccaaggtcagagcacatagagaaaatcttatcggcagcaagctcatgctgtctttcccacattgcttcttgcttctgtgcatc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062191 |
ccttgaggaagaaaccaccaaggtcagagcacatagagaaaatcttatcggcagcaagctcatgctgtctttcccacattgcttcttgcttctgtgcatc |
43062290 |
T |
|
| Q |
299 |
tttcacgaaattgactctcaattgaaaaacctgcaattcgagaaaaatgaagcatgcatagttaattaat |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43062291 |
tttcacgaaattgactctcaattgaaaaacctgcaattcgag-aaaatgaagcatgcatagttaattaat |
43062359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 18 - 134
Target Start/End: Original strand, 43062010 - 43062126
Alignment:
| Q |
18 |
gaagttggtggagcttgatcacagagcgtaaccagccttttcacccatgcagccggtgccaaatccggcttcccaataatttgtgcaatctgaatacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062010 |
gaagttggtggagcttgatcacagagcgtaaccagccttttcacccatgcagccggtgccaaatccggcttcccaataatttgtgcaatctgaatacaaa |
43062109 |
T |
|
| Q |
118 |
aatcaacaaaactagtt |
134 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43062110 |
aatcaacaaaactagtt |
43062126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University