View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_low_21 (Length: 342)
Name: NF1988_low_21
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 19 - 329
Target Start/End: Original strand, 8290310 - 8290624
Alignment:
| Q |
19 |
tagatgctacttgttctgatgcttcagaatatgtcttttgggatagttatcatcctacagaacgagcatacagaaagctcgtagattcagtccttgaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8290310 |
tagatgctacttgttctgatgcttcagaatatgtcttttgggatagttatcatcctacagaacgagcatatagaaagctcgtagattcagtccttgaaag |
8290409 |
T |
|
| Q |
119 |
atatttgaacagattgatatgagcttcattgatttaatttgacttccaagatagtttatcatatttctatggtgcagccaaatttgtattttgatgagtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8290410 |
atatttgaacagattgatatgagcttcattgatttaatttgacttccaagatagtttatcatatttctatggtgcagccaaatttgtattttgatgagtt |
8290509 |
T |
|
| Q |
219 |
tattgaattgcttacttgattgcttaagtatttctttggtgtgggtgattgtttaagttctgttacttggagacttcatatatccacaaata----ggac |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
8290510 |
tattgaattgcttacttgattgcttaagtatttctttggtgtgggtgattgtttaagttctgttacttggagacttcatatattcacaaataggacggac |
8290609 |
T |
|
| Q |
315 |
atcccttgatttttc |
329 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8290610 |
atcccttgatttttc |
8290624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University