View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_low_26 (Length: 312)
Name: NF1988_low_26
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 9216157 - 9216471
Alignment:
| Q |
1 |
ataaaacggcaatcaatatctgtgttttgcgatctcatagctcataagattacttgccatttgaatggtagaagtgttgtaacaaaacactttgcaagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9216157 |
ataaaacggcaatcaatatctgtgttttgcgatctcatagctcataagattacttgccatttgaatggtagaagtgttgtaacaaaaccctttgcaagct |
9216256 |
T |
 |
| Q |
101 |
gttaggttgaaacacaaaacttccccaatcggcatt------------------tgactatgctgaaacatgcaaatttgaatttgaggacaaaagtata |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9216257 |
gttaggttgaaacacaaaacttccccaatcggcattttactatgctgaaacatgtgactatgctgaaacatgcaaatttgaattagaggacaaaagtata |
9216356 |
T |
 |
| Q |
183 |
gcttgtcctagtgttccgttcaagtacttcaacgtgttgatgtatatatcttatgaagatgaggttgcctagaccgtgtcatgtattggtcggctttgtt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9216357 |
ccttgtcctagtgttccgttcaagtacttcaacgtgttgatgtatatatcttatgaagatgaggttgcctagaccgtgccatgtattggtcggctttgtt |
9216456 |
T |
 |
| Q |
283 |
tacagtaaaggaaat |
297 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9216457 |
cacagtaaaggaaat |
9216471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University