View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_low_42 (Length: 231)
Name: NF1988_low_42
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 72 - 209
Target Start/End: Complemental strand, 5933813 - 5933667
Alignment:
| Q |
72 |
ttaatgacacatcttgacagagatgattttggtctcagcaaaagtcactacatgattgcagtgatgcatatcaaatcttttaagaatttcagcattatg- |
170 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
5933813 |
ttaatgtcacatcttgacagagatgattttggtctcggcaagagtcactacatgattgcagtgttgcatatcaaatcttttaagaatttcagcaacatgc |
5933714 |
T |
|
| Q |
171 |
--------tttggtgcattagcagacccctactgcttagaaaatatg |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5933713 |
atgtcttctttggtgcattaggagacccctactgcttagaaaatatg |
5933667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 80
Target Start/End: Complemental strand, 5933895 - 5933830
Alignment:
| Q |
15 |
atgaacatcgttcctatatggttagttctctcatacacaatggaatttttagttaagttaatgaca |
80 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5933895 |
atgaacctcgttcctatatggttagttctctcattcacaatggaatttttagttaagttaatgaca |
5933830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University