View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_low_44 (Length: 217)
Name: NF1988_low_44
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 135 - 193
Target Start/End: Complemental strand, 3245859 - 3245801
Alignment:
| Q |
135 |
acgagaatgttttagaattaagacccacaaacatcgccatttgacatgttcttgtctca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245859 |
acgagaatgttttagaattaagacccacaaacatcgccatttgacatgttcttgtctca |
3245801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3245989 - 3245941
Alignment:
| Q |
1 |
tcttgaatccttcttcttctctcttctgtattgttgttgttgctagcca |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245989 |
tcttgaatccttcttcttctctcttctgtattgttgttgttgctagcca |
3245941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University