View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1988_low_45 (Length: 217)
Name: NF1988_low_45
Description: NF1988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1988_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 52873057 - 52872873
Alignment:
| Q |
16 |
gaaggagaacaacagtcagcgggaatggaagaaatgagaggagacttgagagattgatcggcaagtttaggcaaaatagagccaaatttagcggtcatag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52873057 |
gaaggagaacaacagtcagcgggaatggaagaaatgagaggagatttgagagattgatcggcaagtttaggcaaaatagagccaaatttagcggtcatag |
52872958 |
T |
|
| Q |
116 |
cgttaagcatgtcaccttctttgccatcaacccaattcttcactttaacctgtaacaaataaaaacaaatagttacatatccttc |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52872957 |
cgttaagcatgtcgccttctttgccatcaacccaattcttcactttaacctgtaacaaataaaaacaaatagttacatatccttc |
52872873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University