View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19891_high_20 (Length: 249)
Name: NF19891_high_20
Description: NF19891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19891_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 6155975 - 6155748
Alignment:
| Q |
1 |
gaaaataaaaatctattttgcataaaaatgatcaatttaaaccaaacattaaacatgtaactttctctctctctgnnnnnnnnn-ctttgagaggatgta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6155975 |
gaaaataaaaatctattttgcataaaaatggtcaatttaaaccaaagattaaacatgtaactttctctctctctgttttttttttctttgagaggatgta |
6155876 |
T |
 |
| Q |
100 |
actttactcttcaaattggatttaaattctggttaacagggtattttgaatggtttgttatgtttattgtgcttaccaatggtccagccatatttcagtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6155875 |
actttactcttcaaattggatttaaattctggttaacagggtattttgaatggtttgttatgtttattgtgcttaccaatggtccaaccatatttcagtt |
6155776 |
T |
 |
| Q |
200 |
tctgatgaaccaactaaggaagtttgtt |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
6155775 |
tctgatgaaccaactacagaagtttgtt |
6155748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University