View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19891_high_7 (Length: 345)
Name: NF19891_high_7
Description: NF19891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19891_high_7 |
 | |
|
| [»] chr2 (4 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 76 - 345
Target Start/End: Complemental strand, 4597431 - 4597162
Alignment:
| Q |
76 |
tttctccaaatacattttataattttttatctggagattgagaatgtagtcattgtagtggaatcttatttactttattaatgcatcaacatagttatat |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4597431 |
tttctccaaatacattttataattttttatctggtgattgagaatgtagtcattgtagtggaatcttatttactttattaatgcatcaacatagttatat |
4597332 |
T |
|
| Q |
176 |
gatctaagaccctcttccatttctttcacttgaactgaacccaccaagtccaaccatacaattgtatgatcaaacatgactaagaggccacaaatatatc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4597331 |
gatctaagaccctcttccatttctttcacctgaactgaacccaccaagtccaaccatacaattgtatgatcaaacatgactaagaggccacaaatatatc |
4597232 |
T |
|
| Q |
276 |
ttttcggtgactcaatcactgaggaatcctttgatgttggaggatggggtgcttctcttgccaacttttt |
345 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4597231 |
tttttggtgactcaatcactgaggaatcctttgatgttggaggatggggtgcttctctttccaacttttt |
4597162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 4597580 - 4597503
Alignment:
| Q |
1 |
ataagtaacctcaatgtaaaatagtccaatggatcattttaatatgggatagatggaacagtaaaacttatatttttt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4597580 |
ataagtaacctcaatgtaaaatagtccaatggatcattttaatatgggatagaaggaacagtaaaacttatatttttt |
4597503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 287 - 341
Target Start/End: Complemental strand, 4587651 - 4587597
Alignment:
| Q |
287 |
tcaatcactgaggaatcctttgatgttggaggatggggtgcttctcttgccaact |
341 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
4587651 |
tcaatcactgaagaatcctttggtgttggaggatggggtgcttcttttgccaact |
4587597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 274 - 340
Target Start/End: Complemental strand, 4602206 - 4602140
Alignment:
| Q |
274 |
tcttttcggtgactcaatcactgaggaatcctttgatgttggaggatggggtgcttctcttgccaac |
340 |
Q |
| |
|
|||||||||||| ||||||||||| || || || ||||||||||||||||||||||||||||||| |
|
|
| T |
4602206 |
tcttttcggtgattcaatcactgaagattcattctctgttggaggatggggtgcttctcttgccaac |
4602140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University