View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19891_low_14 (Length: 289)
Name: NF19891_low_14
Description: NF19891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19891_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 41760821 - 41760725
Alignment:
| Q |
19 |
gattaaatgccgtctagcatcaattctaagatcttctttcatctttctaatgaaatcttcaaattttttgtttaactcttcagtacttagcacacaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41760821 |
gattaaatgccgtctagcatcaattctaagatcttctttcatctttctaatgaaatcttcaaattttttgtttaactcttctgtacttagcacacaa |
41760725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 41795607 - 41795516
Alignment:
| Q |
22 |
taaatgccgtctagcatcaattctaagatcttctttcatctttctaatgaaatcttcaaattttttgtttaactcttcagtacttagcacac |
113 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
41795607 |
taaatgccgtctagcatcaattcttagatcttctttcatctttctaatgaaatcttcgaattttttgtttaactcttctgtacttaacacac |
41795516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 184 - 259
Target Start/End: Complemental strand, 41795457 - 41795382
Alignment:
| Q |
184 |
aattagaatgtaatcaatttccgacaatttatctccatcttcatcatctgcatcaaatagttcaacttcttcttct |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41795457 |
aattagaatgtaatcaatttccgaccctttatctccgtcttcatcatctgcatcaaatagttcaacttcttcttct |
41795382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 184 - 256
Target Start/End: Complemental strand, 41760656 - 41760584
Alignment:
| Q |
184 |
aattagaatgtaatcaatttccgacaatttatctccatcttcatcatctgcatcaaatagttcaacttcttct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
41760656 |
aattagaatgtaatcaatttccgacaatttatctccctcatcatcatgtgcatcaaatagttcaacttcttct |
41760584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 23507455 - 23507400
Alignment:
| Q |
56 |
ttcatctttctaatgaaatcttcaaattttttgtttaactcttcagtacttagcac |
111 |
Q |
| |
|
||||||||| ||||||| || |||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
23507455 |
ttcatctttttaatgaagtcatcaaattttttgttcaactcctcagtgcttagcac |
23507400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University