View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19891_low_15 (Length: 285)
Name: NF19891_low_15
Description: NF19891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19891_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 3 - 269
Target Start/End: Complemental strand, 4596933 - 4596668
Alignment:
| Q |
3 |
gtgaaactggattccgtgcactcattggaatcacgcattcgggacattgtttatcgttctaaattttttatttcaaaatatagaaattgaatcttaagtg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4596933 |
gtgaaactggattccgtgcactcattggaatcacgcattcgggacattgttgatcgttctaaattttttatttcaaaatatagaaattgaatcttaagtg |
4596834 |
T |
 |
| Q |
103 |
tctgatcttgatcaaacggccaccattatcatgaatgcgtgactacagaatagccagatccataaggggtcgacaatttgagttaattgcaacccacatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4596833 |
tctgatcttgatcaaacggccaccattatcatgaatgcgtgactacataatagccagatccataaggggtcgacaatttgagttaattgcaacccacatt |
4596734 |
T |
 |
| Q |
203 |
ctgttttttagattttaatgtaaagtttgaatctttctgtaatggggtttgtgtttcttttgaaaag |
269 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4596733 |
ctgt-ttttagattttaatgtaaagtttgaatctttttgtaatggggtttgtgtttcttttgaaaag |
4596668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University