View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19891_low_17 (Length: 262)
Name: NF19891_low_17
Description: NF19891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19891_low_17 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 3 - 252
Target Start/End: Original strand, 49553334 - 49553568
Alignment:
| Q |
3 |
tttgattatgcacttccaaaacattgttactttttatttattagtgataatatttttaaggatttaatttagtggtaaattcttagtacttgaagtttag |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49553334 |
tttgattatgcacttccaaaacattgttactttttatttattagtgataatatttttaaggatttaatttagtggtaaattcttagtacttgaagtttgg |
49553433 |
T |
 |
| Q |
103 |
ttggttaccgatatcttgtaggtaaaattcatttgaaatatgattttatttttaaacatataatataaaaatatgacatgatgctaaataattgaatgat |
202 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49553434 |
ttg---------------taggtaaaattcatttgaaatatgattctatttttaatcatataatataaaaatatgacatgatgttaaataattgaatgat |
49553518 |
T |
 |
| Q |
203 |
atgtacacatttaaggaaacttcaagaataccgttatgttcacaggttct |
252 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||| ||||| ||||| |
|
|
| T |
49553519 |
atgtacacattcaagaaaacttcaagaataccgttatggtcacaagttct |
49553568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 204
Target Start/End: Original strand, 349533 - 349619
Alignment:
| Q |
119 |
tgtaggtaaaattcatttgaaatatgattttatttttaaacata-taatataaaaatatgacatgatgctaaataattgaatgatat |
204 |
Q |
| |
|
|||| |||||| |||||| |||| |||||| ||| ||||| | | ||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
349533 |
tgtatgtaaaactcatttaaaatttgatttgattcttaaataaaataatataaaaatatgacatgatgttaaataattggatgatat |
349619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University