View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19891_low_21 (Length: 249)

Name: NF19891_low_21
Description: NF19891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19891_low_21
NF19891_low_21
[»] chr4 (1 HSPs)
chr4 (1-227)||(6155748-6155975)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 6155975 - 6155748
Alignment:
1 gaaaataaaaatctattttgcataaaaatgatcaatttaaaccaaacattaaacatgtaactttctctctctctgnnnnnnnnn-ctttgagaggatgta 99  Q
    |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||          |||||||||||||||    
6155975 gaaaataaaaatctattttgcataaaaatggtcaatttaaaccaaagattaaacatgtaactttctctctctctgttttttttttctttgagaggatgta 6155876  T
100 actttactcttcaaattggatttaaattctggttaacagggtattttgaatggtttgttatgtttattgtgcttaccaatggtccagccatatttcagtt 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
6155875 actttactcttcaaattggatttaaattctggttaacagggtattttgaatggtttgttatgtttattgtgcttaccaatggtccaaccatatttcagtt 6155776  T
200 tctgatgaaccaactaaggaagtttgtt 227  Q
    ||||||||||||||||  ||||||||||    
6155775 tctgatgaaccaactacagaagtttgtt 6155748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University