View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19891_low_23 (Length: 238)
Name: NF19891_low_23
Description: NF19891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19891_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 28684983 - 28685185
Alignment:
| Q |
18 |
aatatagcattaccatcataatttttatgattatgtgttctatggttgaaggtcactaagttttgaactgataataatataacttgattttgtgannnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28684983 |
aatatagcattaccatcataatttttatgattatgtgttctatggttgaaggtcactaagttttgaactgataataatataacttgattttgtgattttt |
28685082 |
T |
|
| Q |
118 |
nnaactattaaaaattataaactgagatgtggatgttttgtcaatttgtttgcttttctattcagataaattggttatttttatctggatattgttcagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28685083 |
ttaactattaaaaattataaactgagatgtggatgttttgtcaatttgtttgcttttctattcagataaattggttatttttatctggatattgttcagt |
28685182 |
T |
|
| Q |
218 |
att |
220 |
Q |
| |
|
||| |
|
|
| T |
28685183 |
att |
28685185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University