View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19891_low_26 (Length: 218)
Name: NF19891_low_26
Description: NF19891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19891_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 14395812 - 14395626
Alignment:
| Q |
13 |
aatatcaaatgtctagatccacccatgctgtcatgtgaacggaatatatgtgcggaaccttggtactcttattgaacgaatgtttgaaaacttttcttgg |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14395812 |
aatatcaaatgtctagatccgcccatgctgtcatgtgaacggaatatatgtgcggaaccttggtactcttattgaacgaatgtttgaaaacttttcttgg |
14395713 |
T |
 |
| Q |
113 |
tcattgaatgaaatcttcagattcaaagctttcttctgcttatcatcatctgaaacaagatgtcttgcttatctaagaggtacacct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14395712 |
tcattgaatgaaatcttcagattcaaagctttcttctgcttatcatcatctgaaacaagatgtcttgcttatctaagaggtacacct |
14395626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 67 - 116
Target Start/End: Complemental strand, 14398051 - 14398002
Alignment:
| Q |
67 |
gaaccttggtactcttattgaacgaatgtttgaaaacttttcttggtcat |
116 |
Q |
| |
|
|||||||| |||||| ||||||| ||||||||||||||||||||| |||| |
|
|
| T |
14398051 |
gaaccttgctactctgattgaacaaatgtttgaaaacttttcttgttcat |
14398002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 153
Target Start/End: Original strand, 16021702 - 16021793
Alignment:
| Q |
63 |
tgcggaaccttggtactcttattgaacgaatgtttgaaaacttttcttggtcattgaatgaaatcttcagattcaaagc-tttcttctgctt |
153 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |||| ||| |||| | ||||| ||||||||| ||| || |||||||||||| |
|
|
| T |
16021702 |
tgcggaaccttgctactctgcttgaacgaatgtttgaaggctttcgttgttcatagcatgaactcttcagatgcaatgcttttcttctgctt |
16021793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University