View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19892_low_2 (Length: 258)
Name: NF19892_low_2
Description: NF19892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19892_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 6862616 - 6862392
Alignment:
| Q |
19 |
tcaaaatggcaacgtatgtcaatctggcacactaatatttaagtgcagcatactatataatagtatcaatttaaagagagaaaattataagcaaatgtgc |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6862616 |
tcaaaatggcaacgtatatcaatctggcacactaatatttaagtgcagcatactatataatagtatcaatttaaagagagaaaattataagcaaatgtgc |
6862517 |
T |
|
| Q |
119 |
taatgacaccacataaacaaccattatctcctttactttacagtcacaagtctgtttttaatgtgataccaagcgtcggcatatcctaaggtatatattt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
6862516 |
taatgacaccacataaacaaccattatctcctttactttacagtcacaagtctgtttttaatgtaataccaagcgtcggcatatcctaaggtacatattt |
6862417 |
T |
|
| Q |
219 |
caacccaaaatcaaacccttctctg |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6862416 |
caacccaaaatcaaacccttctctg |
6862392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 105 - 206
Target Start/End: Complemental strand, 6857605 - 6857503
Alignment:
| Q |
105 |
ataagcaaatgtgctaatgacaccacataaacaaccattatctcctttactttacagtcacaagtctgtttt-taatgtgataccaagcgtcggcatatc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||| || | ||||||| ||||| | |||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
6857605 |
ataagcaaatgtgctaatgacaccacataaaaaactattatcaccatcactttaccgtcactaatctgttttctaatgtgataccaaccgtcggcgtatc |
6857506 |
T |
|
| Q |
204 |
cta |
206 |
Q |
| |
|
||| |
|
|
| T |
6857505 |
cta |
6857503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University