View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19892_low_3 (Length: 249)
Name: NF19892_low_3
Description: NF19892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19892_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 109 - 231
Target Start/End: Original strand, 29564597 - 29564725
Alignment:
| Q |
109 |
aagatatctttgtcaatgtcatgctgtttcacacctattgtcagtcacccattaatcagtcagt-gtccgtgccgtttaaggcaaagc-----atttgag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
29564597 |
aagatatctttgtcaatgtcatgctgtttcacacctattgtcagtcacccattaatcagtcagtggtccgtgccgtttaaggcaaagcatttgatttgag |
29564696 |
T |
|
| Q |
203 |
attctttatcttcttactacgtacgtact |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29564697 |
attctttatcttcttactacgtacgtact |
29564725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 112
Target Start/End: Original strand, 29564500 - 29564537
Alignment:
| Q |
75 |
tggtataaatgtaaatttagaagtgtttaaatataaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29564500 |
tggtataaatgtaaatttagaagtgtttaaatataaga |
29564537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University