View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19892_low_4 (Length: 228)
Name: NF19892_low_4
Description: NF19892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19892_low_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 29564202 - 29564433
Alignment:
| Q |
1 |
atgacaataataacaacaacgttagacactgtgcnnnnnnngtgactgttatttatttcccaacgtcgagcactgcctcttcatgggaatttgaaaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29564202 |
atgacaataataacaacaacgttagacactgtgctttttgtgtgactgttatttatttcccaacgtcgagcactgcctcttcatgggaatttgaaaaaga |
29564301 |
T |
|
| Q |
101 |
cttgtctggnnnnnnnnnnnnnnnnnnnnnnnacccaatatgccattcattggtcaaccataaatta-tattttaaatttagt---taatcattttcact |
196 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29564302 |
cttgtctggtttttgtttttgtttgtctttttacccaatatgccattcattggtcaaccataaattattattttaaatttagttaataatcattttcact |
29564401 |
T |
|
| Q |
197 |
ttatttcattctattttggtttacacttagtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29564402 |
ttatttcattctattttggtttacacttagtt |
29564433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University