View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19893_high_26 (Length: 244)
Name: NF19893_high_26
Description: NF19893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19893_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 7966896 - 7966672
Alignment:
| Q |
1 |
tgcgttggcaatgaagaggattgtgacggaggcggagaaggtgacggctgaggaggcggtgagattggggatcgttgactcggcgcatgatagcgttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7966896 |
tgcgttggcaatgaagaggattgtgacggaggcggagaaggtgacggctgaggaggcggtgagattggggatcgttgactcggcgcatgatagcgttgag |
7966797 |
T |
|
| Q |
101 |
gaaacggttaaggctgcggttgaactgagctgtgatttggtgaagcgtggattgaatggaggcgtgtatgctgagaataggaagaagcttttgggtcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7966796 |
gaaacggttaaggctgcggttgaattgagcggtgatttggtgaagcgtggattgaatggagacgtgtatgctgagaataggaagaagcttttgggtcatg |
7966697 |
T |
|
| Q |
201 |
tgattgggactgttgaagataaccc |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7966696 |
tgattgggactgttgaagataaccc |
7966672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 7973999 - 7974182
Alignment:
| Q |
19 |
gattgtgacggaggcggagaaggtgacggctgaggaggcggtgagattggggatcgttgactcggcgcatgatagcgttgaggaaacggttaaggctgcg |
118 |
Q |
| |
|
|||||||| | |||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7973999 |
gattgtgatgcaggcggcgaaggtgacggcgaaggaggcggtgagattggggattgttgactcggcgcatgatagcgtggaggaaacggttaaggctgcg |
7974098 |
T |
|
| Q |
119 |
gttgaactgagctgtgatttggtgaagcgtggattgaatggaggcgtgtatgctgagaataggaagaagcttttgggtcatgtg |
202 |
Q |
| |
|
|||||| || | || |||||||||| ||||||| | ||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7974099 |
gttgaattgggtggtaatttggtgaaacgtggatgggatggacacgtgtatgctgagaataggaagaagtttttgggtcatgtg |
7974182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University