View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19893_high_29 (Length: 235)
Name: NF19893_high_29
Description: NF19893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19893_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 19172360 - 19172558
Alignment:
| Q |
16 |
aagaacgagcaagattggtgaagatgaaaggatggaggtcagagatccaaagaagaggcttttctaaggagttatgccagtcttggttgaggatttgaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172360 |
aagaacgagcaagattggtgaagatgaaaggatggaggtcagagatccaaagaagaggcttttctaaggagttatgccagtcttggttgaggatttgaga |
19172459 |
T |
|
| Q |
116 |
agggtctgtggttgcagctgcgtcgagggtgtggtagtaagattggaagtgttggtggatgagctcaacgtgagttgagaggagggttaaggaggcgcc |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19172460 |
agggtctgtgattgcagctgcgtcgagggtgtggtagtaagattggaagtgttggtggatgagctcaacgtgagttgagaggagggttaaggagtcgcc |
19172558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University