View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19893_low_20 (Length: 281)
Name: NF19893_low_20
Description: NF19893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19893_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 43093881 - 43094062
Alignment:
| Q |
13 |
aatatacaagagaagaaagagaaaataaataacctggttttggtttttcctcctaatggggtgattaaatttgcagttgaatccaaacttgcaactccca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43093881 |
aatatacaagagaagaaagagaaaataaataacctggttttggtttttcctcctaatggggtgattaaatttgcagttgaatccaaacttgcaactccca |
43093980 |
T |
|
| Q |
113 |
gtcttcatataaaatgaacaatcttcagcttcaggcctcaaagggaattgatgagttccatcactgcttttctcttccttct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43093981 |
gtcttcatataaaatgaacaatcttcagcttcaggcctcaaagggaattgatgagttccatcactgcttttctcttccttct |
43094062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 71 - 153
Target Start/End: Original strand, 34207379 - 34207461
Alignment:
| Q |
71 |
gggtgattaaatttgcagttgaatccaaacttgcaactcccagtcttcatataaaatgaacaatcttcagcttcaggcctcaa |
153 |
Q |
| |
|
||||||||||| ||||| ||||||||||| |||||| | |||||||| | |||||| ||||| |||||||||||||||||||| |
|
|
| T |
34207379 |
gggtgattaaacttgcaattgaatccaaatttgcaagttccagtcttgagataaaaagaacagtcttcagcttcaggcctcaa |
34207461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University