View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19893_low_21 (Length: 280)
Name: NF19893_low_21
Description: NF19893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19893_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 266
Target Start/End: Complemental strand, 29010842 - 29010604
Alignment:
| Q |
20 |
actaatagaagtcattccttaaaattcttccaggtaccaatatcttgactgaatgtgggacgtgggttatgtcgggtacttaatggaaggaattatccac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29010842 |
actaatagaagtcattccttaaaattcttccaggtaccaatatcttgactgaatgtgggacgtgggttatgtcgggtacttaatggaaggaattatccac |
29010743 |
T |
 |
| Q |
120 |
acaatggatatgttgaagcctttcaagcactctactgttattgaagcacaaccacgttgttggtggtattcttactttcttagatcaccaatttccattc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29010742 |
acaatggatatgttgaagcctttcaagcactctactgttattgaagcacaaccacgttgttggtggtatt--------cttagatcaccaatttccattc |
29010651 |
T |
 |
| Q |
220 |
caaattagatattgttgctgtggggtggcgtgtcaggttttcgcttc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29010650 |
caaattagatattgttgctgtggggtggcgtgtcaggttttcgcttc |
29010604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University