View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19893_low_23 (Length: 276)
Name: NF19893_low_23
Description: NF19893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19893_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 232
Target Start/End: Complemental strand, 36293721 - 36293498
Alignment:
| Q |
9 |
caaaggtatggtatcagtctgaaatgtgagccgacaaccaagtttatctaccaaagaaccggtgcttaagctcccaataaatgcgccagcaataaatata |
108 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36293721 |
caaaggtatggtatcgatctgaaatgtgagccgacaaccaagtttatctaccaaagaaccggtgcttaagctcccaataaatgcgccagcaataaatata |
36293622 |
T |
 |
| Q |
109 |
cttacaacaagtccctcaatgaatgagtttccttcaaaaccaagttcccgggcaatggaaacgatgggaccattcattaccctgcaaagtatgtaatcca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
36293621 |
cttacaacaagtccctcaatgaatgagtttccttcaaaaccaagttcccgggcaatggaaatgatgggaccattcataatcctgcaaagtatgtaatcca |
36293522 |
T |
 |
| Q |
209 |
gtttgaaacacttcccaagaggct |
232 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36293521 |
gtttgaaacacttcccaagaggct |
36293498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University