View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19893_low_29 (Length: 244)

Name: NF19893_low_29
Description: NF19893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19893_low_29
NF19893_low_29
[»] chr7 (2 HSPs)
chr7 (1-225)||(7966672-7966896)
chr7 (19-202)||(7973999-7974182)


Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 7966896 - 7966672
Alignment:
1 tgcgttggcaatgaagaggattgtgacggaggcggagaaggtgacggctgaggaggcggtgagattggggatcgttgactcggcgcatgatagcgttgag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7966896 tgcgttggcaatgaagaggattgtgacggaggcggagaaggtgacggctgaggaggcggtgagattggggatcgttgactcggcgcatgatagcgttgag 7966797  T
101 gaaacggttaaggctgcggttgaactgagctgtgatttggtgaagcgtggattgaatggaggcgtgtatgctgagaataggaagaagcttttgggtcatg 200  Q
    |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
7966796 gaaacggttaaggctgcggttgaattgagcggtgatttggtgaagcgtggattgaatggagacgtgtatgctgagaataggaagaagcttttgggtcatg 7966697  T
201 tgattgggactgttgaagataaccc 225  Q
    |||||||||||||||||||||||||    
7966696 tgattgggactgttgaagataaccc 7966672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 7973999 - 7974182
Alignment:
19 gattgtgacggaggcggagaaggtgacggctgaggaggcggtgagattggggatcgttgactcggcgcatgatagcgttgaggaaacggttaaggctgcg 118  Q
    |||||||| | |||||| ||||||||||||  |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
7973999 gattgtgatgcaggcggcgaaggtgacggcgaaggaggcggtgagattggggattgttgactcggcgcatgatagcgtggaggaaacggttaaggctgcg 7974098  T
119 gttgaactgagctgtgatttggtgaagcgtggattgaatggaggcgtgtatgctgagaataggaagaagcttttgggtcatgtg 202  Q
    |||||| || |  || |||||||||| ||||||| | |||||  ||||||||||||||||||||||||| ||||||||||||||    
7974099 gttgaattgggtggtaatttggtgaaacgtggatgggatggacacgtgtatgctgagaataggaagaagtttttgggtcatgtg 7974182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University