View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19894_low_5 (Length: 238)
Name: NF19894_low_5
Description: NF19894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19894_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 2909620 - 2909419
Alignment:
| Q |
1 |
tagttactcgtttgtttccactcatgtgtattttttgtatacgtgtgaaaaataaatatactaattgtaaattaaaaaatgatgannnnnnngatgaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
2909620 |
tagttactcgtttgtttccactcatgtgtattttttgtatacgtctgaaaaataaatatattaattgtaaattaaaaaatgatgatttttttgatgaata |
2909521 |
T |
|
| Q |
101 |
aaacaattcatttttataaatgatgatgaatttttaagtagtaattttgatatcgtattaaacttgttctttttagggttttcaatatgtttatgctgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2909520 |
aaacaattcatttttataaatgatgatgaatttttaagtagtaatttttatatcgtatttaacttgttctttttagggttttcaatttgtttatgctgag |
2909421 |
T |
|
| Q |
201 |
tg |
202 |
Q |
| |
|
|| |
|
|
| T |
2909420 |
tg |
2909419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 223
Target Start/End: Complemental strand, 2909401 - 2909373
Alignment:
| Q |
195 |
gctgagtgagattgaacacagatggatct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2909401 |
gctgagtgagattgaacacagatggatct |
2909373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University